MultiPro® 5CFLX Anti-Human IL-6 (4G3E6)

NeutraKine® IL-6 Monoclonal Antibody for Single Cell (Intra)
Cat No. G69001-1-5C
Clone No.4G3E6

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

B cell stimulatory factor 2, BSF 2, BSF2, CDF, CTL differentiation factor, HGF, HSF, Hybridoma growth factor, IL 6, IL6, IL-6, Interferon beta 2, Interleukin 6, NeutraKine® IL-6

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G69001-1-5C targets NeutraKine® IL-6 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen NeutraKine® IL-6 fusion protein HZ-1019 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human IL-6 (4G3E6)
Gene Symbol IL6
Gene ID (NCBI) 3569
ENSEMBL Gene IDENSG00000136244
RRIDAB_3673972
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGACCGCACAGCGAATTCCCATATAAGAAA
Barcode SequenceACCGCACAGCGAATT
Form Liquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells involved in lymphocyte and monocyte differentiation. It induces myeloma and plasmacytoma growth and induces nerve cells differentiation Acts on B-cells, T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. IL-6 is also considered a myokine, a cytokine produced from muscle, and is elevated in response to muscle contraction. IL-6 has been shown to interact with interleukin-6 receptor and glycoprotein 130. Additionally, IL-6 is involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

This antibody can be used to neutralize the bioactivity of IL-6.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...