MultiPro® 5CFLX Anti-Human c-SRC (5E10C4)

• 

  Single Cell Sequencing experiment G60315-1-5C on Resting PBMC

  G60315-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G60315-1-5C on PBMC treated with 4hr LPS + TI

  G60315-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

c-SRC Monoclonal Antibody for Single Cell (Intra)

Cat No. G60315-1-5C

Clone No.5E10C4

Host / Isotype

Mouse / IgG2b

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

ASV, c SRC, c-SRC, p60 Src, pp60c src, Proto oncogene c Src, SRC, SRC1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G60315-1-5C targets c-SRC in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2b
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: c-SRC fusion protein Ag22306
• Full Name: MultiPro® 5CFLX Anti-Human c-SRC (5E10C4)
• Calculated Molecular Weight: 60 kDa
• GenBank Accession Number: BC011566
• Gene Symbol: SRC
• Gene ID (NCBI): 6714
• ENSEMBL Gene ID: ENSG00000197122
• RRID: AB_3673902
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTACAAGGCTCATCCCCATATAAGAAA
• Barcode Sequence: GGTACAAGGCTCATC
• Form: Liquid
• UNIPROT ID: P12931
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

SRC, also named as SRC1 and p60-Src, belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. It is a non-receptor protein tyrosine kinase that plays pivotal roles in numerous cellular processes such as proliferation, migration, and transformation. In concert with PTK2B, SRC plays an important role in osteoclastic bone resorption. It promotes energy production in osteoclasts by activating mitochondrial cytochrome C oxidase.