MultiPro® 5CFLX Anti-Human ZAP70 (1A11G9)

• 

  Single Cell Sequencing experiment G60200-1-5C on Resting PBMC

  G60200-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G60200-1-5C on PBMC treated with 4hr LPS + TI

  G60200-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

ZAP70 Monoclonal Antibody for Single Cell (Intra)

Cat No. G60200-1-5C

Host / Isotype

Mouse / IgG2a

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

70 kDa zeta associated protein, SRK, STD, Syk related tyrosine kinase, Tyrosine protein kinase ZAP 70, TZK, ZAP 70, ZAP70

Formulation:  PBS and Azide

PBS and Azide

Conjugate:  {{ptg:cur_Conjugation}}

Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

- +

Request bulk or custom quote

Add to Basket

Please visit your regions distributor:

---

Proteintech Guarantee

---

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G60200-1-5C targets ZAP70 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: ZAP70 fusion protein Ag7943
• Full Name: MultiPro® 5CFLX Anti-Human ZAP70 (1A11G9)
• Calculated Molecular Weight: 70 kDa
• GenBank Accession Number: BC039039
• Gene Symbol: ZAP70
• Gene ID (NCBI): 7535
• ENSEMBL Gene ID: ENSG00000115085
• RRID: AB_3673899
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTCTACCGCGCGACGCCCATATAAGAAA
• Barcode Sequence: CTCTACCGCGCGACG
• Form: Liquid
• UNIPROT ID: P43403
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Zeta-associated protein (ZAP)-70, a member of the Syk family of tyrosine kinases, plays an important role in T-cell receptor signaling, natural killer (NK) cell activation and early B-cell development. ZAP-70 is expressed in a subset of cases of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) with unmutated immunoglobulin heavy-chain variable region (IgVH) genes and is associated with poor clinical outcome.