MultiPro® 5CFLX Anti-Human Vimentin (Polyclonal)

• 

  Single Cell Sequencing experiment G10366-1-5C on Resting PBMC

  G10366-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G10366-1-5C on PBMC treated with 4hr LPS + TI

  G10366-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

Vimentin Polyclonal Antibody for Single Cell (Intra)

Cat No. G10366-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

VIM, vimentin

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G10366-1-5C targets Vimentin in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: Vimentin fusion protein Ag0489
• Full Name: MultiPro® 5CFLX Anti-Human Vimentin (Polyclonal)
• Calculated Molecular Weight: 466 aa, 54 kDa
• GenBank Accession Number: BC000163
• Gene Symbol: VIM
• Gene ID (NCBI): 7431
• ENSEMBL Gene ID: ENSG00000026025
• RRID: AB_3673880
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCTAATCGTATTGCCCCATATAAGAAA
• Barcode Sequence: TCCTAATCGTATTGC
• Form: Liquid
• UNIPROT ID: P08670
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Vimentin, also named as VIM, belongs to the intermediate filament family. Vimentin is class-III intermediate filaments found in various non-epithelial cells, especially mesenchymal cells. Vimentin is important for stabilizing the architecture of the cytoplasm. Monocyte-derived macrophages secrete vimentin into the extracellular space in vitro. Secretion of vimentin was enhanced by the proinflammatory cytokine tumor necrosis factor-alpha (TNFA; 191160) and inhibited by the antiinflammatory cytokine IL10 (124092), suggesting that vimentin is involved in the immune response. Vimentin has specialized functions that contribute to specific dynamic cellular processes. As a phosphoprotein, 55-60 kDa of vimentin proteins can be observed due to the different phosphorylation level. Isoforms of vimentin (49 kDa and 60 kDa) had also been reported. (PMID: 8640945, 22728585).