Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G67244-1-5C targets TPM4 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | TPM4 fusion protein Ag6947 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human TPM4 (2E12D12) |
Calculated Molecular Weight | 248 aa, 29 kDa |
GenBank Accession Number | BC037576 |
Gene Symbol | TPM4 |
Gene ID (NCBI) | 7171 |
ENSEMBL Gene ID | ENSG00000167460 |
RRID | AB_3673963 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGTCACCGCATATATACCCCATATAAGAAA |
Barcode Sequence | TCACCGCATATATAC |
Form | Liquid |
UNIPROT ID | P67936 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
TPM4 is a member of tropomyosins (TPMs), a multi-gene family of actin-binding proteins present in all eukaryotic cells. In muscle, TPMs are responsible for mediating contraction via regulation of the actin-myosin interaction. As to non-muscle cells, its proposed role is to stabilize the actin filaments by modulating the interaction with proteins that are responsible for the regulation of actin dynamics. The form of TPM4 in muscle has a higher molecular weight than the form found in non-muscle cells.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |