Product Information
G13700-1-5C targets TBX21,T-bet in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Rabbit / IgG |
| Class | Oligo Conjugate |
| Type | Polyclonal |
| Immunogen | TBX21,T-bet fusion protein Ag4618 Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human TBX21/T-bet (Polyclonal) |
| Calculated Molecular Weight | 535 aa, 58 kDa |
| GenBank Accession Number | BC039739 |
| Gene Symbol | TBX21/T-bet |
| Gene ID (NCBI) | 30009 |
| ENSEMBL Gene ID | ENSG00000073861 |
| RRID | AB_3673886 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGGTTCAATCCGGACGCCCATATAAGAAA |
| Barcode Sequence | GGTTCAATCCGGACG |
| Form | Liquid |
| UNIPROT ID | Q9UL17 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
TBX21 is a transcription factor that drives the Th1 immune response primarily through promoting expression of the IFN-γ gene. TBX21 initiates TH1 lineage development from naive TH precursor cells both by activating TH1 genetic programs and by repressing the opposing TH2 programs. It has also been shown to play an influential role in inflammatory processes such as inflammatory bowel disease, autoimmune diseases such as rheumatoid arthritis, and immune-mediated conditions like asthma.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |
