MultiPro® 5CFLX Anti-Human SYK (4C4A12)

• 

  Single Cell Sequencing experiment G66721-1-5C on Resting PBMC

  G66721-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66721-1-5C on PBMC treated with 4hr LPS + TI

  G66721-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

SYK Monoclonal Antibody for Single Cell (Intra)

Cat No. G66721-1-5C

Clone No.4C4A12

Host / Isotype

Mouse / IgG2b

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

DKFZp313N1010, FLJ25043, FLJ37489, spleen tyrosine kinase, SYK, Tyrosine protein kinase SYK

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66721-1-5C targets SYK in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2b
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: SYK fusion protein Ag17654
• Full Name: MultiPro® 5CFLX Anti-Human SYK (4C4A12)
• Calculated Molecular Weight: 635 aa, 72 kDa
• GenBank Accession Number: BC001645
• Gene Symbol: SYK
• Gene ID (NCBI): 6850
• ENSEMBL Gene ID: ENSG00000165025
• RRID: AB_3673959
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGTGATGCGCTGACGCCCATATAAGAAA
• Barcode Sequence: CGTGATGCGCTGACG
• Form: Liquid
• UNIPROT ID: P43405
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

SYK(spleen tyrosine kinase) is a key regulator of signal transduction events,apoptosis and orderly cell cycle progression in B-lineage lymphoid cells. Although SYK has not been linked to a human disease, defective expression of the closely related T-cell tyrosine kinase ZAP-70 has been associated with severe combined immunodeficiency(PMID:11494125). This protein has 2 isoforms produced by alternative splicing. SYK also promotes liver fibrosis by activation of hepatic stellate cells and acts as a biomarker for human hepatocellular carcinoma. (PMID: 29537660)