MultiPro® 5CFLX Anti-Human SP1 (4G3H3)

• 

  Single Cell Sequencing experiment G66508-1-5C on Resting PBMC

  G66508-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66508-1-5C on PBMC treated with 4hr LPS + TI

  G66508-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

SP1 Monoclonal Antibody for Single Cell (Intra)

Cat No. G66508-1-5C

Clone No.4G3H3

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

SP1, Sp1 transcription factor, Transcription factor Sp1, TSFP1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66508-1-5C targets SP1 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: SP1 fusion protein Ag16720
• Full Name: MultiPro® 5CFLX Anti-Human SP1 (4G3H3)
• Calculated Molecular Weight: 785 aa, 81 kDa
• GenBank Accession Number: BC062539
• Gene Symbol: SP1
• Gene ID (NCBI): 6667
• ENSEMBL Gene ID: ENSG00000185591
• RRID: AB_3673956
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCATTGCGGATTAGCCCCATATAAGAAA
• Barcode Sequence: TCATTGCGGATTAGC
• Form: Liquid
• UNIPROT ID: P08047
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

The transcription factor Sp1 is a C2H2 zinc-finger protein that is involved in the regulation of a wide variety of genes, including housekeeping genes and tumor-developing genes. It is associated with tumor development, growth, and metastasis [PMID: 16209919]. It regulates the expression of a large number of genes involved in a variety of processes such as cell growth, apoptosis, differentiation and immune responses. Besides, it has a role in modulating the cellular response to DNA damage, recruiting SMARCA4/BRG1 on the c-FOS promoter, regulation of FE65 gene expression [PMID:11371615,16332679]. SP1 has some isoforms with MW ~95-106 kDa and ~60 kDa [PMID:17462816].