MultiPro® 5CFLX Anti-Human S100A4 (2G11B4)

S100A4 Monoclonal Antibody for Single Cell (Intra)
Cat No. G66489-1-5C
Clone No.2G11B4

Host / Isotype

Mouse / IgG2a

Reactivity

Human

Applications

Single Cell (Intra)

18A2, 42A, Calvasculin, CAPL, Fibroblast-specific protein 1, FSP1, FSP-1, Metastasin, MTS1, P9KA, PEL98, Protein Mts1, Protein S100 A4, S100A4

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66489-1-5C targets S100A4 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG2a
Class Oligo Conjugate
Type Monoclonal
Immunogen S100A4 fusion protein Ag9019 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human S100A4 (2G11B4)
Calculated Molecular Weight 101 aa, 12 kDa
GenBank Accession NumberBC016300
Gene Symbol S100A4
Gene ID (NCBI) 6275
ENSEMBL Gene IDENSG00000196154
RRIDAB_3673955
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGGTACCGCGCTCGAGACCCATATAAGAAA
Barcode SequenceGTACCGCGCTCGAGA
Form Liquid
UNIPROT IDP26447
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

S100A4 is a member of the S100 family of calcium-binding proteins. The S100 family members have been involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100A4 is known to localize to and function in the nucleus, cytoplasm of cells, and the extracellular space. S100A4 has also been shown to be associated with tumor growth, motility, invasion, metastasis, angiogenesis, apoptosis, and chemoresistance. It is a fibroblast-specific protein associated with mesenchymal cell morphology and motility, is expressed during epithelial-mesenchymal transformations (EMT) in vivo (PMID: 9362334). It is a specific prognostic marker for renal survival in patients with IgAN (PMID: 16105038). It is also an improved marker for lung fibroblasts that could be useful for investigating the pathogenesis of pulmonary fibrosis(PMID: 15618458). Overexpression of S100A4 is correlated with a worse prognosis inpatients with various types of cancer.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...