MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6)

• 

  Single Cell Sequencing experiment G80084-1-5C on Resting PBMC

  G80084-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G80084-1-5C on PBMC treated with 4hr LPS + TI

  G80084-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

Phospho-Beta Catenin (Ser675) Recombinant Antibody for Single Cell (Intra)

Cat No. G80084-1-5C

Clone No.6D6

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

b cat, Beta catenin, Catenin beta 1, CTNNB, CTNNB1, DKFZp686D02253, FLJ25606, FLJ37923, PRO2286

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G80084-1-5C targets Phospho-Beta Catenin (Ser675) in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Recombinant
• Immunogen: Peptide
• Full Name: MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6)
• Calculated Molecular Weight: 781 aa, 86 kDa
• GenBank Accession Number: BC058926
• Gene Symbol: Beta Catenin
• Gene ID (NCBI): 1499
• ENSEMBL Gene ID: ENSG00000168036
• RRID: AB_3673975
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATATCTTAATCCGAACCCATATAAGAAA
• Barcode Sequence: ATATCTTAATCCGAA
• Form: Liquid
• UNIPROT ID: P35222
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

β-Catenin, also known as CTNNB1, is an evolutionarily conserved, multifunctional intracellular protein. β-Catenin was originally identified in cell adherens junctions (AJs) where it functions to bridge the cytoplasmic domain of cadherins to a-catenin and the actin cytoskeleton. Besides its essential role in the AJs, β-catenin is also a key downstream component of the canonical Wnt pathway that plays diverse and critical roles in embryonic development and adult tissue homeostasis. The Wnt/β-catenin pathway is also involved in the activation of other intracellular messengers such as calcium fluxes, JNK, and SRC kinases. Deregulation of β-catenin activity is associated with multiple diseases including cancers. (PMID: 22617422; 18334222). PKA was shown to phosphorylate β-catenin at Ser675. Phosphorylation at Ser675 induces β-catenin accumulation in the nucleus and increases its transcriptional activity.