MultiPro® 5CFLX Anti-Human POU2AF1 (3C5A7)

POU2AF1 Monoclonal Antibody for Single Cell (Intra)
Cat No. G66659-1-5C

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

BOB 1, BOB1, OBF 1, OBF1, OCA B, OCAB, OCT binding factor 1, POU2AF1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66659-1-5C targets POU2AF1 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen POU2AF1 fusion protein Ag23613 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human POU2AF1 (3C5A7)
Calculated Molecular Weight 256 aa, 27 kDa
GenBank Accession NumberBC032549
Gene Symbol POU2AF1
Gene ID (NCBI) 5450
ENSEMBL Gene IDENSG00000110777
RRIDAB_3673958
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGGGTATCCGCAAGCGTCCCATATAAGAAA
Barcode SequenceGGTATCCGCAAGCGT
Form Liquid
UNIPROT IDQ16633
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

POU2AF1, also named as BOB-1 or OCA-B, is a 256 amino acid protein, which belongs to the POU2AF1 family. POU2AF1 is expressed in B-cell specific. POU2AF1 as a transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers.The predicted size of this protein is 27 kDa. Studies have reported that the protein has a multi-band size of 34-35 kDa through siRNA interference experiments (PMID: 17621271). This result is the same as our experiments.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...