Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G67487-1-5C targets MFN2 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG2a |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | MFN2 fusion protein Ag29873 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human MFN2 (5F3B3) |
Calculated Molecular Weight | 757 aa, 86 kDa |
GenBank Accession Number | BC017061 |
Gene Symbol | MFN2 |
Gene ID (NCBI) | 9927 |
ENSEMBL Gene ID | ENSG00000116688 |
RRID | AB_3673964 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCGCCACCAATGACCTCCCATATAAGAAA |
Barcode Sequence | CGCCACCAATGACCT |
Form | Liquid |
UNIPROT ID | O95140 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
MFN2, also named as CPRP1 and KIAA0214, belongs to the mitofusin family. It is an Essential transmembrane GTPase, which mediates mitochondrial fusion. MFN2 acts independently of the cytoskeleton. It therefore plays a central role in mitochondrial metabolism and may be associated with obesity and/or apoptosis processes. Overexpression of MFN2 induces the formation of mitochondrial networks. It plays an important role in the regulation of vascular smooth muscle cell proliferation. Defects in MFN2 are the cause of Charcot-Marie-Tooth disease type 2A2 (CMT2A2). Defects in MFN2 are the cause of Charcot-Marie-Tooth disease type 6 (CMT6). Ubiquitinated forms of Mfn2 (mono- and polyubiquitinated) are present during mitophagy.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |