MultiPro® 5CFLX Anti-Human MAFB (Polyclonal)

• 

  Single Cell Sequencing experiment G20189-1-5C on Resting PBMC

  G20189-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G20189-1-5C on PBMC treated with 4hr LPS + TI

  G20189-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

MAFB Polyclonal Antibody for Single Cell (Intra)

Cat No. G20189-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

KRML, Maf B, MAFB, Transcription factor MafB

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G20189-1-5C targets MAFB in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: MAFB fusion protein Ag14102
• Full Name: MultiPro® 5CFLX Anti-Human MAFB (Polyclonal)
• Calculated Molecular Weight: 323 aa, 36 kDa
• GenBank Accession Number: BC036689
• Gene Symbol: MAFB
• Gene ID (NCBI): 9935
• ENSEMBL Gene ID: ENSG00000204103
• RRID: AB_3673893
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGCGGACCAGGAATCCCATATAAGAAA
• Barcode Sequence: TCGCGGACCAGGAAT
• Form: Liquid
• UNIPROT ID: Q9Y5Q3
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

MAFB (MAF BZIP Transcription Factor B), also known as V-maf musculoaponeurotic fibrosarcoma oncogene homolog B, is a widely expressed basic leucine zipper transcription factor belonging to the Maf family. MAFB expression is significantly elevated in response to a broad range of metabolic and immunological stimuli that promote macrophage M2 polarization, cholesterol efflux, or both, whereas it is strongly down-regulated in response to various pro-inflammatory pathogenic triggers(PMID: 28790455). MAFB is highly expressed in tumor tissues and required for proliferation and tumorigenicity of osteosarcoma cells(PMID: 32234710) and is a marker of tumor-associated macrophages in both mouse and human(PMID: 31679694).