Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G81042-1-5C targets Lamin A/C in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Recombinant |
Immunogen | Lamin A/C fusion protein Ag0408 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human Lamin A/C (5I16) |
Calculated Molecular Weight | 65 kDa |
GenBank Accession Number | BC003162 |
Gene Symbol | Lamin A/C |
Gene ID (NCBI) | 4000 |
ENSEMBL Gene ID | ENSG00000160789 |
RRID | AB_3673977 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAAGTGGAGTGTGTCTCCCATATAAGAAA |
Barcode Sequence | AAGTGGAGTGTGTCT |
Form | Liquid |
UNIPROT ID | P02545 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Lamin A/C is also named as LMNA, or LMN1. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. The lack of lamin A/C can be as a novel marker for undifferentiated embryonic stem cells and lamin A/C expression is as an early indicator of differentiation (PMID: 16179429). Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. This protein has 4 isoforms produced by alternative splicing with the molecular weight of 74 kDa, 65 kDa, 70 kDa and 64 kDa. This antibody can recognize 4 isoforms of Lamin A/C.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |