Filter:
Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G66414-1-5C targets LDLR in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1 |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen | LDLR fusion protein Ag1236 Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human LDLR (1A2A3) |
| Calculated Molecular Weight | 95 kDa |
| GenBank Accession Number | BC014514 |
| Gene Symbol | LDLR |
| Gene ID (NCBI) | 3949 |
| ENSEMBL Gene ID | ENSG00000130164 |
| RRID | AB_3673953 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAGCAGGACTAACGAGCCCATATAAGAAA |
| Barcode Sequence | AGCAGGACTAACGAG |
| Form | Liquid |
| UNIPROT ID | P01130 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
LDLR (low density lipoprotein receptor) is a member of the LDL receptor gene family and is involved in receptor-mediated endocytosis of specific ligands. The LDLR is a cell surface glycoprotein that scavenges LDL from the blood and regulates plasma LDL cholesterol. The cytoplasmic domain of the LDL receptor is necessary for the receptor to cluster in coated pits, which promotes the rapid endocytosis of bound LDL. The protein is highly glycosylated through N- and O-linkages and thus migrates at 100 to 160 kDa bands on SDS-PAGE.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |
