MultiPro® 5CFLX Anti-Human L-selectin/CD62L (Polyclonal)

• 

  Single Cell Sequencing experiment G26477-1-5C on Resting PBMC

  G26477-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G26477-1-5C on PBMC treated with 4hr LPS + TI

  G26477-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

L-selectin / CD62L Polyclonal Antibody for Single Cell (Intra)

Cat No. G26477-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD62L, gp90 MEL, hLHRc, LAM 1, LAM1, LECAM1, Leu 8, Leukocyte adhesion molecule 1, LNHR, LSEL, L-selectin, Lyam 1, LYAM1, Lymph node homing receptor, PLNHR, selectin L, SELL, TQ1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G26477-1-5C targets L-selectin / CD62L in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: L-selectin / CD62L fusion protein Ag24063
• Full Name: MultiPro® 5CFLX Anti-Human L-selectin/CD62L (Polyclonal)
• Calculated Molecular Weight: 42 kDa
• GenBank Accession Number: BC020758
• Gene Symbol: CD62L
• Gene ID (NCBI): 6402
• ENSEMBL Gene ID: ENSG00000188404
• RRID: AB_3673896
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGCTTCGCTGAACCGCCCATATAAGAAA
• Barcode Sequence: AGCTTCGCTGAACCG
• Form: Liquid
• UNIPROT ID: P14151
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD62L, also known as L-selectin or SELL, is a member of the selectin family of adhesion molecules that also include CD62E (E-selectin) and CD62P (P-selectin) (PMID: 2663882, 2473156, 1382078). CD62L is a highly glycosylated protein of 95-105 kDa on neutrophils and 74 kDa on lymphocytes (PMID: 1382078; 1694883, 1695155). CD62L is expressed on the surface of most leukocytes, including lymphocytes, neutrophils, monocytes, eosinophils, hematopoietic progenitor cells, and immature thymocytes (PMID: 1694883, 1688580). It mediates the binding of lymphocytes to high endothelial venules (HEV) of peripheral lymph nodes through interactions with a constitutively expressed ligand, and is also involved in lymphocyte, neutrophil, and monocyte attachment to endothelium at sites of inflammation (PMID: 1382078).