Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G26477-1-5C targets L-selectin / CD62L in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen | L-selectin / CD62L fusion protein Ag24063 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human L-selectin/CD62L (Polyclonal) |
Calculated Molecular Weight | 42 kDa |
GenBank Accession Number | BC020758 |
Gene Symbol | CD62L |
Gene ID (NCBI) | 6402 |
ENSEMBL Gene ID | ENSG00000188404 |
RRID | AB_3673896 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAGCTTCGCTGAACCGCCCATATAAGAAA |
Barcode Sequence | AGCTTCGCTGAACCG |
Form | Liquid |
UNIPROT ID | P14151 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD62L, also known as L-selectin or SELL, is a member of the selectin family of adhesion molecules that also include CD62E (E-selectin) and CD62P (P-selectin) (PMID: 2663882, 2473156, 1382078). CD62L is a highly glycosylated protein of 95-105 kDa on neutrophils and 74 kDa on lymphocytes (PMID: 1382078; 1694883, 1695155). CD62L is expressed on the surface of most leukocytes, including lymphocytes, neutrophils, monocytes, eosinophils, hematopoietic progenitor cells, and immature thymocytes (PMID: 1694883, 1688580). It mediates the binding of lymphocytes to high endothelial venules (HEV) of peripheral lymph nodes through interactions with a constitutively expressed ligand, and is also involved in lymphocyte, neutrophil, and monocyte attachment to endothelium at sites of inflammation (PMID: 1382078).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |