MultiPro® 5CFLX Anti-Human IL-1 Beta (2A1B4)

IL-1 Beta Monoclonal Antibody for Single Cell (Intra)

Cat No. G66737-1-5C
Clone No.2A1B4

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Catabolin, IL 1, IL 1 beta, IL1 BETA, IL-1 beta, IL1B, IL-1B, IL1beta, IL1F2, Interleukin 1 beta, interleukin 1, beta

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66737-1-5C targets IL-1 Beta in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen IL-1 Beta fusion protein Ag26030 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human IL-1 Beta (2A1B4)
Calculated Molecular Weight 269 aa, 31 kDa
GenBank Accession NumberBC008678
Gene Symbol IL1B
Gene ID (NCBI) 3553
ENSEMBL Gene IDENSG00000125538
RRIDAB_3673960
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTGAGTGGATTGTTCTCCCATATAAGAAA
Barcode SequenceTGAGTGGATTGTTCT
Form Liquid
UNIPROT IDP01584
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Interleukin-1 is a pro-inflammatory cytokine with multiple biological effects. The IL-1 gene family encodes three proteins: IL-1α, IL-1β and their naturally occurring inhibitor Il-1RN. IL-1 Beta(IL-1β), mainly produced by blood monocytes and tissue macrophages, has been implicated in mediating both acute and chronic inflammation. IL-1β is known to be involved in a variety of cellular activities, including cell proliferation, differentiation and apoptosis. IL-1β is emerging as a key mediator of carcinogenesis that characterizes host-environment interactions. Human IL-1β is synthesized as a 31 kDa precursor. To gain activity, the precursor must be cleaved by caspase-1 between Asp116 and Ala117 to yield a 17 kDa mature form.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...