MultiPro® 5CFLX Anti-Human IL-1 Beta (2A1B4)

• 

  Single Cell Sequencing experiment G66737-1-5C on Resting PBMC

  G66737-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66737-1-5C on PBMC treated with 4hr LPS + TI

  G66737-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

IL-1 Beta Monoclonal Antibody for Single Cell (Intra)

Cat No. G66737-1-5C

Clone No.2A1B4

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

Catabolin, IL 1, IL 1 beta, IL1 BETA, IL-1 beta, IL1B, IL-1B, IL1beta, IL1F2, Interleukin 1 beta, interleukin 1, beta

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66737-1-5C targets IL-1 Beta in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: IL-1 Beta fusion protein Ag26030
• Full Name: MultiPro® 5CFLX Anti-Human IL-1 Beta (2A1B4)
• Calculated Molecular Weight: 269 aa, 31 kDa
• GenBank Accession Number: BC008678
• Gene Symbol: IL1B
• Gene ID (NCBI): 3553
• ENSEMBL Gene ID: ENSG00000125538
• RRID: AB_3673960
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGAGTGGATTGTTCTCCCATATAAGAAA
• Barcode Sequence: TGAGTGGATTGTTCT
• Form: Liquid
• UNIPROT ID: P01584
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Interleukin-1 is a pro-inflammatory cytokine with multiple biological effects. The IL-1 gene family encodes three proteins: IL-1α, IL-1β and their naturally occurring inhibitor Il-1RN. IL-1 Beta(IL-1β), mainly produced by blood monocytes and tissue macrophages, has been implicated in mediating both acute and chronic inflammation. IL-1β is known to be involved in a variety of cellular activities, including cell proliferation, differentiation and apoptosis. IL-1β is emerging as a key mediator of carcinogenesis that characterizes host-environment interactions. Human IL-1β is synthesized as a 31 kDa precursor. To gain activity, the precursor must be cleaved by caspase-1 between Asp116 and Ala117 to yield a 17 kDa mature form.