MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)

• 

  Single Cell Sequencing experiment G69007-1-5C on Resting PBMC

  G69007-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G69007-1-5C on PBMC treated with 4hr LPS + TI

  G69007-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G69001-1-5C on PBMC treated with 4hr PMA + TI

  G69007-1-5C was used to stain PBMC under 4hr PMA + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

NeutraKine® IFN Gamma Monoclonal Antibody for Single Cell (Intra)

Cat No. G69007-1-5C

Clone No.1E10G7

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

IFG, IFI, IFN gamma, IFN γ, IFNG, IFN-gamma, IFNγ, IFN-γ, Immune interferon, Interferon gamma, interferon, gamma, NeutraKine® IFN Gamma

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: NeutraKine® IFN Gamma fusion protein HZ-1301
• Full Name: MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)
• Gene Symbol: IFNG
• Gene ID (NCBI): 3458
• ENSEMBL Gene ID: ENSG00000111537
• RRID: AB_3673973
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA
• Barcode Sequence: CGAGAGAATGACTGC
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Interferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.

This antibody can be used to neutralize the bioactivity of Interferon gamma.