MultiPro® 5CFLX Anti-Human GATA2 (2B5A1)

• 

  Single Cell Sequencing experiment G67722-1-5C on Resting PBMC

  G67722-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G67722-1-5C on PBMC treated with 4hr LPS + TI

  G67722-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

GATA2 Monoclonal Antibody for Single Cell (Intra)

Cat No. G67722-1-5C

Clone No.2B5A1

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

FLJ45948, GATA binding protein 2, GATA2, NFE1B

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G67722-1-5C targets GATA2 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: GATA2 fusion protein Ag1557
• Full Name: MultiPro® 5CFLX Anti-Human GATA2 (2B5A1)
• GenBank Accession Number: BC018988
• Gene Symbol: GATA2
• Gene ID (NCBI): 2624
• ENSEMBL Gene ID: ENSG00000179348
• RRID: AB_3673967
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCACGCCGTCACGAGCCCATATAAGAAA
• Barcode Sequence: TCACGCCGTCACGAG
• Form: Liquid
• UNIPROT ID: P23769
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

GATA2 is a member of GATA family of transcription factors that contains zinc fingers in DNA binding domain. GATA2 acts as a transcriptinal activator that regulates endothelin-1 expression in endothelial cells. Together with GATA3, GATA2 regulates adipocyte differentiation through molecular control of the preadpocyte-adipocyte transition. It also affect the activity of Rho inhibitor p190RhoGAP that controls capillary network formation in vitro and retinal angiogenesis in vivo.