MultiPro® 5CFLX Anti-Human ENO1 (2C20)

ENO1 Recombinant Antibody for Single Cell (Intra)
Cat No. G81478-1-5C
Clone No.2C20

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Alpha enolase, C myc promoter binding protein, ENO1, ENO1L1, Enolase 1, enolase 1, (alpha), MBP 1, MBPB1, MPB 1, MPB1, NNE, Non neural enolase, Phosphopyruvate hydratase, Plasminogen binding protein, PPH

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G81478-1-5C targets ENO1 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Rabbit / IgG
Class Oligo Conjugate
Type Recombinant
Immunogen ENO1 fusion protein Ag1692 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human ENO1 (2C20)
Calculated Molecular Weight 47 kDa
GenBank Accession NumberBC015641
Gene Symbol ENO1
Gene ID (NCBI) 2023
ENSEMBL Gene IDENSG00000074800
RRIDAB_3673978
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCTTGTTACATAGACTCCCATATAAGAAA
Barcode SequenceCTTGTTACATAGACT
Form Liquid
UNIPROT IDP06733
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

ENO1, also named as NNE, ENO1L1, MBPB1, MPB1 and MBP1, belongs to the enolase family. ENO1 is a metabolic enzyme involved in the synthesis of pyruvate. It also acts as a plasminogen receptor and mediates the activation of plasmin and extracellular matrix degradation. In tumor cells, ENO1 is up-regulated and supports the Warburg effect; it is expressed at the cell surface, where it promotes cancer invasion, and is subjected to a specific array of post-translational modifications, namely acetylation, methylation and phosphorylation. ENO1 overexpression and post-translational modifications could be of diagnostic and prognostic value in many cancer types. (PMID: 27814656). This antibody is specific to ENO1 and has no cross-reaction with ENO2 and ENO3.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...