Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G81478-1-5C targets ENO1 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Recombinant |
Immunogen | ENO1 fusion protein Ag1692 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human ENO1 (2C20) |
Calculated Molecular Weight | 47 kDa |
GenBank Accession Number | BC015641 |
Gene Symbol | ENO1 |
Gene ID (NCBI) | 2023 |
ENSEMBL Gene ID | ENSG00000074800 |
RRID | AB_3673978 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCTTGTTACATAGACTCCCATATAAGAAA |
Barcode Sequence | CTTGTTACATAGACT |
Form | Liquid |
UNIPROT ID | P06733 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
ENO1, also named as NNE, ENO1L1, MBPB1, MPB1 and MBP1, belongs to the enolase family. ENO1 is a metabolic enzyme involved in the synthesis of pyruvate. It also acts as a plasminogen receptor and mediates the activation of plasmin and extracellular matrix degradation. In tumor cells, ENO1 is up-regulated and supports the Warburg effect; it is expressed at the cell surface, where it promotes cancer invasion, and is subjected to a specific array of post-translational modifications, namely acetylation, methylation and phosphorylation. ENO1 overexpression and post-translational modifications could be of diagnostic and prognostic value in many cancer types. (PMID: 27814656). This antibody is specific to ENO1 and has no cross-reaction with ENO2 and ENO3.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |