MultiPro® 5CFLX Anti-Human ENO1 (2C20)

• 

  Single Cell Sequencing experiment G81478-1-5C on Resting PBMC

  G81478-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G81478-1-5C on PBMC treated with 4hr LPS + TI

  G81478-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

ENO1 Recombinant Antibody for Single Cell (Intra)

Cat No. G81478-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

Alpha enolase, C myc promoter binding protein, ENO1, ENO1L1, Enolase 1, enolase 1, (alpha), MBP 1, MBPB1, MPB 1, MPB1, NNE, Non neural enolase, Phosphopyruvate hydratase, Plasminogen binding protein, PPH

Formulation:  PBS and Azide

PBS and Azide

Conjugate:  {{ptg:cur_Conjugation}}

Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

- +

Request bulk or custom quote

Add to Basket

Please visit your regions distributor:

---

Proteintech Guarantee

---

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G81478-1-5C targets ENO1 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Recombinant
• Immunogen: ENO1 fusion protein Ag1692
• Full Name: MultiPro® 5CFLX Anti-Human ENO1 (2C20)
• Calculated Molecular Weight: 47 kDa
• GenBank Accession Number: BC015641
• Gene Symbol: ENO1
• Gene ID (NCBI): 2023
• ENSEMBL Gene ID: ENSG00000074800
• RRID: AB_3673978
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTTGTTACATAGACTCCCATATAAGAAA
• Barcode Sequence: CTTGTTACATAGACT
• Form: Liquid
• UNIPROT ID: P06733
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

ENO1, also named as NNE, ENO1L1, MBPB1, MPB1 and MBP1, belongs to the enolase family. ENO1 is a metabolic enzyme involved in the synthesis of pyruvate. It also acts as a plasminogen receptor and mediates the activation of plasmin and extracellular matrix degradation. In tumor cells, ENO1 is up-regulated and supports the Warburg effect; it is expressed at the cell surface, where it promotes cancer invasion, and is subjected to a specific array of post-translational modifications, namely acetylation, methylation and phosphorylation. ENO1 overexpression and post-translational modifications could be of diagnostic and prognostic value in many cancer types. (PMID: 27814656). This antibody is specific to ENO1 and has no cross-reaction with ENO2 and ENO3.