MultiPro® 5CFLX Anti-Human CD86 (BU63)

CD86 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65165-1-5C
Clone No.BU63

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Activation B7 2 antigen, B7 2, B70, BU63, CD28LG2, CD86, CD86 molecule, CTLA 4 counter receptor B7.2, FUN 1, LAB72

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65165-1-5C targets CD86 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen B-lymphoblastoid cell line ARH 77 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD86 (BU63)
Calculated Molecular Weight 329 aa, 38 kDa
GenBank Accession NumberBC040261
Gene Symbol CD86
Gene ID (NCBI) 942
ENSEMBL Gene IDENSG00000114013
RRIDAB_3673923
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCCGAGTTGCGAAGTTCCCATATAAGAAA
Barcode SequenceCCGAGTTGCGAAGTT
Form Liquid
UNIPROT IDP42081
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD86 (also known as B7.2) is a costimulatory molecule belonging to the immunoglobulin superfamily. Primarily expressed on antigen-presenting cells (APCs), including B cells, dendritic cells, and macrophages, CD86 is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of CD86 with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of CD86 with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...