Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65195-1-5C targets CD81 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
fusion protein Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD81 (5A6) |
Calculated Molecular Weight | 26 kDa |
GenBank Accession Number | BC002978 |
Gene Symbol | CD81 |
Gene ID (NCBI) | 975 |
ENSEMBL Gene ID | ENSG00000110651 |
RRID | AB_3673932 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGTCAATAGTTGGCTACCCATATAAGAAA |
Barcode Sequence | GTCAATAGTTGGCTA |
Form | Liquid |
UNIPROT ID | P60033 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD81 (also known as TAPA1or TSPAN28) is a membrane protein of the tetraspanin superfamily, which are characterized by the presence of four conserved transmembrane regions. Many of these members are expressed on leukocytes and have been implicated in signal transduction, cell-cell interactions, and cellular activation and development. CD81 is involved in signal transduction and cell adhesion in the immune system (PMID: 9597125). CD81 has also been identified as en essential receptor for HCV (hepatitis C virus) (PMID: 21428934).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |