MultiPro® 5CFLX Anti-Human CD8 (UCHT4)

CD8 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65204-1-5C
Clone No.UCHT4

Host / Isotype

Mouse / IgG2a

Reactivity

Human

CD8, CD8A, CD8a molecule, Leu2, MAL, p32

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65204-1-5C targets CD8 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG2a
Class Oligo Conjugate
Type Monoclonal
Immunogen Thymocytes and Sézary T cells Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD8 (UCHT4)
Calculated Molecular Weight 235 aa, 26 kDa
GenBank Accession NumberBC025715
Gene Symbol CD8A
Gene ID (NCBI) 925
ENSEMBL Gene IDENSG00000153563
RRIDAB_3673935
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTGGAATCTAATACCACCCATATAAGAAA
Barcode SequenceTGGAATCTAATACCA
Form Liquid
UNIPROT IDP01732
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD8 is a transmembrane glycoprotein composed of two disulfide-linked chains. It can be present as a homodimer of CD8α or as a heterodimer of CD8α and CD8β (PMID: 3264320; 8253791). CD8 is found on most thymocytes. The majority of class I-restricted T cells express mostly the CD8αβ heterodimer while CD8αα homodimers alone have been found on some gut intraepithelial T cells , on some T cell receptor (TCR) γδ T cells and on NK cells (PMID: 2111591; 1831127; 8420975). CD8 acts as a co-receptor that binds to MHC class-I and participates in cytotoxic T cell activation (PMID: 8499079). During T cell development, CD8 is required for positive selection of CD4-/CD8+ T cells (PMID: 1968084).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...