MultiPro® 5CFLX Anti-Human CD71 (3C11F11)

• 

  Single Cell Sequencing experiment G66180-1-5C on Resting PBMC

  G66180-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66180-1-5C on PBMC treated with 4hr LPS + TI

  G66180-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD71 Monoclonal Antibody for Single Cell (Intra)

Cat No. G66180-1-5C

Clone No.3C11F11

Host / Isotype

Mouse / IgG2a

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD71, p90, sTfR, T9, TFR, TFR1, TFRC, TR, Transferrin receptor protein 1, TRFR

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66180-1-5C targets CD71 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: CD71 fusion protein Ag21612
• Full Name: MultiPro® 5CFLX Anti-Human CD71 (3C11F11)
• Calculated Molecular Weight: 85 kDa
• GenBank Accession Number: BC001188
• Gene Symbol: CD71
• Gene ID (NCBI): 7037
• ENSEMBL Gene ID: ENSG00000072274
• RRID: AB_3673944
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAACCACACTTACGTTCCCATATAAGAAA
• Barcode Sequence: AACCACACTTACGTT
• Form: Liquid
• UNIPROT ID: P02786
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD71, also known as transferrin receptor protein 1 (TfR1), is a transmembrane glycoprotein composed of two disulfide-linked monomers, each of 90 kDa molecular weight. Each monomer binds one holo-transferrin molecule creating an iron-Tf-TfR complex which enters the cell by endocytosis. CD71 is present on actively proliferating cells and is essential for iron transport into proliferating cells.