MultiPro® 5CFLX Anti-Human CD64 (10.1)

CD64 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65253-1-5C
Clone No.10.1

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD64, CD64A, Fc gamma RI, Fc gamma RIA, FCG1, FcgammaRIa, FCGR1, FCGR1A, FCRI, FLJ18345, IGFR1, IgG Fc receptor I

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65253-1-5C targets CD64 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human rheumatoid synovial fluid cells and fibronectin-purified monocytes. Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD64 (10.1)
Calculated Molecular Weight 374 aa, 43 kDa
GenBank Accession NumberBC032634
Gene Symbol FCGR1A
Gene ID (NCBI) 2209
ENSEMBL Gene IDENSG00000150337
RRIDAB_3673939
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCCATCGCCAGCGCGGCCCATATAAGAAA
Barcode SequenceCCATCGCCAGCGCGG
Form Liquid
UNIPROT IDP12314
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Fcγ receptor comprise a multigene family of integral membrane glycoproteins that exhibit complex activation or inhibitory effects on cell functions after aggregation by complexed immunoglobulin G (IgG) (PMID: 17005690 ). CD64, also known as FcγRIA, is a high-affinity receptor for the Fc region of IgG. It is expressed by monocytes/macrophages, activated neutrophils, dendritic cells, and early myeloid cells (PMID: 23293080; 19642859; 7680917). CD64 functions in both innate and adaptive immune responses.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...