Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
SINGLE CELL | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65253-1-5C targets CD64 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | Human rheumatoid synovial fluid cells and fibronectin-purified monocytes. Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD64 (10.1) |
Calculated Molecular Weight | 374 aa, 43 kDa |
GenBank Accession Number | BC032634 |
Gene Symbol | FCGR1A |
Gene ID (NCBI) | 2209 |
ENSEMBL Gene ID | ENSG00000150337 |
RRID | AB_3673939 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCCATCGCCAGCGCGGCCCATATAAGAAA |
Barcode Sequence | CCATCGCCAGCGCGG |
Form | Liquid |
UNIPROT ID | P12314 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Fcγ receptor comprise a multigene family of integral membrane glycoproteins that exhibit complex activation or inhibitory effects on cell functions after aggregation by complexed immunoglobulin G (IgG) (PMID: 17005690 ). CD64, also known as FcγRIA, is a high-affinity receptor for the Fc region of IgG. It is expressed by monocytes/macrophages, activated neutrophils, dendritic cells, and early myeloid cells (PMID: 23293080; 19642859; 7680917). CD64 functions in both innate and adaptive immune responses.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |