MultiPro® 5CFLX Anti-Human CD54/ICAM-1 (15.2)

• 

  Single Cell Sequencing experiment G65075-1-5C on Resting PBMC

  G65075-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65075-1-5C on PBMC treated with 4hr LPS + TI

  G65075-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD54 (ICAM-1) Monoclonal Antibody for Single Cell (Intra)

Cat No. G65075-1-5C

Clone No.15.2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

BB2, CD54, ICAM 1, ICAM1, ICAM-1, P3.58

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65075-1-5C targets CD54 (ICAM-1) in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Rheumatoid synovial cells and human monocytes
• Full Name: MultiPro® 5CFLX Anti-Human CD54/ICAM-1 (15.2)
• Calculated Molecular Weight: 90 kDa
• GenBank Accession Number: BC015969
• Gene Symbol: ICAM-1
• Gene ID (NCBI): 3383
• ENSEMBL Gene ID: ENSG00000090339
• RRID: AB_3673909
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGTGTTGTGGAGATCCCCATATAAGAAA
• Barcode Sequence: AGTGTTGTGGAGATC
• Form: Liquid
• UNIPROT ID: P05362
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

ICAM-1 (CD54) is a 90-kDa transmembrane glycoprotein of the immunoglobulin superfamily and is critical for the firm attachment and transmigration of leukocytes out of blood vessels and into tissues (PMID: 19307690). ICAM-1 is expressed by several cell types, typically on endothelial cells and cells of the immune system, and its expression can be up-regulated by various stimuli, including TNF-α, INF-γ, IL-1 and thrombin (PMID: 3086451; 9694714; 15979056). It is a ligand for LFA-1 and Mac-1, serves as a receptor for rhinovirus, and is one of several receptors used by Plasmodium falciparum (PMID: 2566624; 2538244; 2475784).