MultiPro® 5CFLX Anti-Human CD5 (UCHT2)

CD5 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65152-1-5C
Clone No.UCHT2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD5, CD5 molecule, LEU1, Lymphocyte antigen T1/Leu 1, T1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65152-1-5C targets CD5 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD5 (UCHT2)
Calculated Molecular Weight 495 aa, 55 kDa
GenBank Accession NumberBC027901
Gene Symbol CD5
Gene ID (NCBI) 921
ENSEMBL Gene IDENSG00000110448
RRIDAB_3673921
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGGTGCCTCGCATTGCACCCATATAAGAAA
Barcode SequenceGTGCCTCGCATTGCA
Form Liquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD5 is a type I transmembrane glycoprotein of the scavenger receptor cysteine-rich family (PMID: 12403363). CD5 is expressed on a majority of thymocytes, mature T cells, B cell subsets, and peripheral blood dendritic cells (PMID: 9858516; 6156984; 10379049; 1384337). CD5 may act as a receptor in regulating T-cell proliferation. It functions as a negative regulator of TCR signaling during thymocyte development (PMID: 7542801).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...