MultiPro® 5CFLX Anti-Human CD45 (HI30)

• 

  Single Cell Sequencing experiment G65109-1-5C on Resting PBMC

  G65109-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65109-1-5C on PBMC treated with 4hr LPS + TI

  G65109-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65109-1-5C on Resting PBMC

  G65109-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65109-1-5C on PBMC treated with 4hr LPS + TI

  G65109-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD45 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65109-1-5C

Clone No.HI30

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

B220, CD45, CD45R, GP180, HI30, L CA, LCA, Leukocyte common antigen, LY5, PTPRC, RPTPC, T200

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65109-1-5C targets CD45 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Human peripheral blood leucocytes
• Full Name: MultiPro® 5CFLX Anti-Human CD45 (HI30)
• GenBank Accession Number: BC014239
• Gene Symbol: CD45
• Gene ID (NCBI): 5788
• ENSEMBL Gene ID: ENSG00000081237
• RRID: AB_3673914
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCCAATTACCCCCATATAAGAAA
• Barcode Sequence: TGTGAGCCAATTACC
• Form: Liquid
• UNIPROT ID: P08575
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD45, also known as protein tyrosine phosphatase, receptor type C, is a type I transmembrane protein expressed on the surface of all haematopoietic cells with the exception of erythrocytes and platelets (PMID: 3489673; 28615666). CD45 is a pan-haematopoietic cell marker and has been shown to be essential for T- and B-cell activation and signalling (PMID: 9429890; 16378097).