MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)

• 

  Single Cell Sequencing experiment G65063-1-5C on Resting PBMC

  G65063-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65063-1-5C on PBMC treated with 4hr LPS + TI

  G65063-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65063-1-5C on Resting PBMC

  G65063-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65063-1-5C on PBMC treated with 4hr LPS + TI

  G65063-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD44 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65063-1-5C

Clone No.F10-44-2

Host / Isotype

Mouse / IgG2a, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD44, CD44 antigen, CDW44, CSPG8, ECMR III, Epican, HCELL, Heparan sulfate proteoglycan, Hermes antigen, HUTCH I, Hyaluronate receptor, IN, LHR, MC56, MDU2, MDU3, MIC4, MUTCH I, PGP 1, PGP I, Pgp1, Phagocytic glycoprotein 1, Phagocytic glycoprotein I

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65063-1-5C targets CD44 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Purified T cells from human lymph nodes
• Full Name: MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)
• Calculated Molecular Weight: 742 aa, 82 kDa
• GenBank Accession Number: BC004372
• Gene Symbol: CD44
• Gene ID (NCBI): 960
• ENSEMBL Gene ID: ENSG00000026508
• RRID: AB_3673907
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAACAGCGTGCCGATTCCCATATAAGAAA
• Barcode Sequence: AACAGCGTGCCGATT
• Form: Liquid
• UNIPROT ID: P16070
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD44 is a type I transmembrane glycoprotein expressed on embryonic stem cells and in various levels on other cell types including connective tissues and bone marrow. CD44 expression is also upregulated in subpopulations of cancer cells and is recognized as a molecular marker for cancer stem cells (PMID: 29747682). It is a cell-surface receptor that mediates cell-cell and cell-matrix interactions through its affinity for hyaluronic acid (HA) and possibly also through its affinity for other ligands (PMID: 10694938). Adhesion with HA plays an important role in cell migration, tumor growth and progression. CD44 is also involved in lymphocyte activation, recirculation and homing, and in hematopoiesis.