MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)

CD44 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65063-1-5C
Clone No.F10-44-2

Host / Isotype

Mouse / IgG2a, kappa

Reactivity

Human

CD44, CD44 antigen, CDW44, CSPG8, ECMR III, Epican, HCELL, Heparan sulfate proteoglycan, Hermes antigen, HUTCH I, Hyaluronate receptor, IN, LHR, MC56, MDU2, MDU3, MIC4, MUTCH I, PGP 1, PGP I, Pgp1, Phagocytic glycoprotein 1, Phagocytic glycoprotein I

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65063-1-5C targets CD44 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG2a, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Purified T cells from human lymph nodes Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)
Calculated Molecular Weight 742 aa, 82 kDa
GenBank Accession NumberBC004372
Gene Symbol CD44
Gene ID (NCBI) 960
ENSEMBL Gene IDENSG00000026508
RRIDAB_3673907
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGAACAGCGTGCCGATTCCCATATAAGAAA
Barcode SequenceAACAGCGTGCCGATT
Form Liquid
UNIPROT IDP16070
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD44 is a type I transmembrane glycoprotein expressed on embryonic stem cells and in various levels on other cell types including connective tissues and bone marrow. CD44 expression is also upregulated in subpopulations of cancer cells and is recognized as a molecular marker for cancer stem cells (PMID: 29747682). It is a cell-surface receptor that mediates cell-cell and cell-matrix interactions through its affinity for hyaluronic acid (HA) and possibly also through its affinity for other ligands (PMID: 10694938). Adhesion with HA plays an important role in cell migration, tumor growth and progression. CD44 is also involved in lymphocyte activation, recirculation and homing, and in hematopoiesis.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...