MultiPro® 5CFLX Anti-Human CD43 (2A11D6)

• 

  Single Cell Sequencing experiment G66224-1-5C on Resting PBMC

  G66224-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66224-1-5C on PBMC treated with 4hr LPS + TI

  G66224-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD43 Monoclonal Antibody for Single Cell (Intra)

Cat No. G66224-1-5C

Clone No.2A11D6

Host / Isotype

Mouse / IgG2b

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD43, Galactoglycoprotein, GALGP, GPL115, Leukocyte sialoglycoprotein, Leukosialin, LSN, sialophorin, SPN

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66224-1-5C targets CD43 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2b
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: CD43 fusion protein Ag23595
• Full Name: MultiPro® 5CFLX Anti-Human CD43 (2A11D6)
• Calculated Molecular Weight: 400 aa, 43 kDa
• GenBank Accession Number: BC012350
• Gene Symbol: CD43
• Gene ID (NCBI): 6693
• ENSEMBL Gene ID: ENSG00000197471
• RRID: AB_3673945
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACAATCCTAACGGCCCATATAAGAAA
• Barcode Sequence: CCACAATCCTAACGG
• Form: Liquid
• UNIPROT ID: P16150
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD43, also named leukosialin, sialophorin, galactoglycoprotein, leukocyte sialoglycoprotein, SPN, and is a mucin-like type I transmembrane protein. In humans, it is expressed in haematopoietic cells, including T lymphocytes, monocytes, granulocytes, natural killer cells, platelets, and haematopoietic stem cells, with the exception of mature erythrocytes and B cell subpopulations. The unglycosylated form of CD43 migrates on SDS-PAGE with a molecular weight of 54 kDa (PMID: 2943740), whereas CD43 from different haematopoietic cell lines displays increased molecular weights since it is glycosylated with O-linked chains that differ in core structure and sialylation.