MultiPro® 5CFLX Anti-Human CD42b (AK2)

• 

  Single Cell Sequencing experiment G65163-1-5C on Resting PBMC

  G65163-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65163-1-5C on PBMC treated with 4hr LPS + TI

  G65163-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD42b Monoclonal Antibody for Single Cell (Intra)

Cat No. G65163-1-5C

Clone No.AK2

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

AK2, BSS, CD42B, CD42b alpha, GP1B, GP1BA, GPIb alpha, GPIbα

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65163-1-5C targets CD42b in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Human platelets
• Full Name: MultiPro® 5CFLX Anti-Human CD42b (AK2)
• Calculated Molecular Weight: 626 aa, 69 kDa
• GenBank Accession Number: BC027955
• Gene Symbol: CD42b
• Gene ID (NCBI): 2811
• ENSEMBL Gene ID: ENSG00000185245
• RRID: AB_3673922
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGTCCATCGGACGCCCCATATAAGAAA
• Barcode Sequence: CCGTCCATCGGACGC
• Form: Liquid
• UNIPROT ID: P07359
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD42b, also known as platelet glycoprotein Ib alpha chain (GPIb alpha), is a type I transmembrane glycoprotein of 135-145 kDa (PMID: 2656709). It is expressed on platelets and megakaryocytes. CD42b and CD42c (GPIb beta) are linked by a disulphide bond to form GPIb (PMID: 7660135). GPIb forms a noncovalent complex with CD42a (GPIX) and CD42d (GPV) and acts as a receptor for von Willebrand factor (vWF) and thrombin (PMID: 7660135; 3759960). The GPIb-V-IX complex mediates vWF-dependent platelet adhesion to blood vessels. Defects in the expression of CD42b result in Bernard-Soulier syndromes and platelet-type von Willebrand disease (PMID: 9371310).