This product is currently not available for sale.
Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65163-1-5C targets CD42b in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1 |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen | Human platelets Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human CD42b (AK2) |
| Calculated Molecular Weight | 626 aa, 69 kDa |
| GenBank Accession Number | BC027955 |
| Gene Symbol | CD42b |
| Gene ID (NCBI) | 2811 |
| ENSEMBL Gene ID | ENSG00000185245 |
| RRID | AB_3673922 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCCGTCCATCGGACGCCCCATATAAGAAA |
| Barcode Sequence | CCGTCCATCGGACGC |
| Form | Liquid |
| UNIPROT ID | P07359 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD42b, also known as platelet glycoprotein Ib alpha chain (GPIb alpha), is a type I transmembrane glycoprotein of 135-145 kDa (PMID: 2656709). It is expressed on platelets and megakaryocytes. CD42b and CD42c (GPIb beta) are linked by a disulphide bond to form GPIb (PMID: 7660135). GPIb forms a noncovalent complex with CD42a (GPIX) and CD42d (GPV) and acts as a receptor for von Willebrand factor (vWF) and thrombin (PMID: 7660135; 3759960). The GPIb-V-IX complex mediates vWF-dependent platelet adhesion to blood vessels. Defects in the expression of CD42b result in Bernard-Soulier syndromes and platelet-type von Willebrand disease (PMID: 9371310).
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |
