MultiPro® 5CFLX Anti-Human CD40 (G28.5)

• 

  Single Cell Sequencing experiment G65103-1-5C on Resting PBMC

  G65103-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65103-1-5C on PBMC treated with 4hr LPS + TI

  G65103-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD40 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65103-1-5C

Clone No.G28.5

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

B cell surface antigen CD40, Bp50, CD40, CD40L receptor, CDW40, p50, TNFRSF5

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65103-1-5C targets CD40 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: N/A
• Full Name: MultiPro® 5CFLX Anti-Human CD40 (G28.5)
• Calculated Molecular Weight: 277 aa, 31 kDa
• GenBank Accession Number: BC012419
• Gene Symbol: CD40
• Gene ID (NCBI): 958
• ENSEMBL Gene ID: ENSG00000101017
• RRID: AB_3673913
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTGCTATGACGTACCCCATATAAGAAA
• Barcode Sequence: ATTGCTATGACGTAC
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD40, also named as TNFRSF5 and Bp50, is a type I transmembrane protein that belongs to the tumor necrosis factor-R (TNF-R) family (PMID: 10647992). CD40 is expressed on B cells, dendritic cells (DCs), monocytes, platelets, and macrophages as well as by non-hematopoietic cells such as myofibroblasts, fibroblasts, epithelial, and endothelial cells (PMID: 19426221). It is a receptor for TNFSF5/CD40LG. CD40L/CD40 interactions are essential for immunoglobulin (Ig) isotype switching, germinal center formation and the development of B cell memory (PMID: 7516405; 11675497).