Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65111-1-5C targets CD38 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
N/A Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD38 (HIT2) |
Calculated Molecular Weight | 300 aa, 34 kDa |
GenBank Accession Number | BC007964 |
Gene Symbol | CD38 |
Gene ID (NCBI) | 952 |
ENSEMBL Gene ID | ENSG00000004468 |
RRID | AB_3673916 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGTTCGATGGTGATCGACCCATATAAGAAA |
Barcode Sequence | TTCGATGGTGATCGA |
Form | Liquid |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD38, also known as ADP-ribosyl cyclase 1, is a type II transmembrane glycoprotein with a short N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites (PMID: 2319135). The extracellular domain of CD38 has bifunctional enzyme activities that catalyze synthesis of cyclic ADP ribose from nicotinamide adenine dinucleotide (NAD) and hydrolysis of cyclic ADP ribose to adenosine diphosphoribose (PMID: 10636863). CD38 is expressed on a variety of hematopoietic and non-hematopoietic cells and is involved in diverse processes such as generation of calcium-mobilizing metabolites, cell activation, and chemotaxis (PMID: 25938500).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |