MultiPro® 5CFLX Anti-Human CD38 (HIT2)

• 

  Single Cell Sequencing experiment G65111-1-5C on Resting PBMC

  G65111-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65111-1-5C on PBMC treated with 4hr LPS + TI

  G65111-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD38 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65111-1-5C

Clone No.HIT2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

ADP ribosyl cyclase 1, cADPr hydrolase 1, CD38, CD38 molecule, Cyclic ADP ribose hydrolase 1, T10

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65111-1-5C targets CD38 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: N/A
• Full Name: MultiPro® 5CFLX Anti-Human CD38 (HIT2)
• Calculated Molecular Weight: 300 aa, 34 kDa
• GenBank Accession Number: BC007964
• Gene Symbol: CD38
• Gene ID (NCBI): 952
• ENSEMBL Gene ID: ENSG00000004468
• RRID: AB_3673916
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTCGATGGTGATCGACCCATATAAGAAA
• Barcode Sequence: TTCGATGGTGATCGA
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD38, also known as ADP-ribosyl cyclase 1, is a type II transmembrane glycoprotein with a short N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites (PMID: 2319135). The extracellular domain of CD38 has bifunctional enzyme activities that catalyze synthesis of cyclic ADP ribose from nicotinamide adenine dinucleotide (NAD) and hydrolysis of cyclic ADP ribose to adenosine diphosphoribose (PMID: 10636863). CD38 is expressed on a variety of hematopoietic and non-hematopoietic cells and is involved in diverse processes such as generation of calcium-mobilizing metabolites, cell activation, and chemotaxis (PMID: 25938500).