MultiPro® 5CFLX Anti-Human CD31 (3F8E2)

CD31 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G66065-2-5C
Clone No.3F8E2

Host / Isotype

Mouse / IgG1

Reactivity

Human

CD31, EndoCAM, FLJ58394, GPIIA, PECA1, PECAM 1, PECAM1, VEC marker

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66065-2-5C targets CD31 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen CD31 fusion protein Ag19730 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD31 (3F8E2)
Calculated Molecular Weight 83 kDa
GenBank Accession NumberBC022512
Gene Symbol CD31
Gene ID (NCBI) 5175
ENSEMBL Gene IDENSG00000261371
RRIDAB_3673942
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTATAACACCTGGTATCCCATATAAGAAA
Barcode SequenceTATAACACCTGGTAT
FormLiquid
UNIPROT IDP16284
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Platelet endothelial cell adhesion molecule-1 (PECAM-1, CD31) is a member of the immunoglobulin gene superfamily of cell adhesion molecules. CD31 is a transmembrane glycoprotein that is highly expressed on the surface of the endothelium, making up a large portion of its intracellular junctions. PECAM-1 is also present on the surface of hematopoietic cells and immune cells including platelets, monocytes, neutrophils, natural killer cells, megakaryocytes and some types of T-cell (PMID: 9011572). As well as its role in cell-cell adhesion, PECAM-1 functions as a signaling receptor, and is involved in important physiological events such as nitric oxide production, regulation of T-cell immunity and tolerance, leukocyte transendothelial migration and inflammation and angiogenesis (PMID: 21183735; 20978210; 17872453; 20634489).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...