MultiPro® 5CFLX Anti-Human CD3 (OKT3)

• 

  Single Cell Sequencing experiment G65133-1-5C on Resting PBMC

  G65133-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65133-1-5C on PBMC treated with 4hr LPS + TI

  G65133-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD3 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65133-1-5C

Clone No.OKT3

Host / Isotype

Mouse / IgG2a, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD3, CD3E, T3E, TCRE

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65133-1-5C targets CD3 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Human T cells
• Full Name: MultiPro® 5CFLX Anti-Human CD3 (OKT3)
• Calculated Molecular Weight: 207 aa, 23 kDa
• GenBank Accession Number: BC049847
• Gene Symbol: CD3
• Gene ID (NCBI): 916
• ENSEMBL Gene ID: ENSG00000198851
• RRID: AB_3673918
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGGATAAGACCTTCCCCATATAAGAAA
• Barcode Sequence: TCGGATAAGACCTTC
• Form: Liquid
• UNIPROT ID: P07766
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD3 is a multimeric protein associated with the T-cell receptor (TCR) to form a complex involved in antigen recognition and signal transduction (PMID: 15885124). CD3 is composed of CD3γ, δ, ε, and ζ chains (PMID: 1826255). It is expressed by thymocytes in a developmentally regulated manner, T cells, and some NK cells (PMID: 3289580). The TCR recognizes antigens bound to major histocompatibility complex (MHC) molecules. TCR-mediated peptide-MHC recognition is transmitted to the CD3 complex, leading to the intracellular signal transduction (PMID: 11985657).