MultiPro® 5CFLX Anti-Human CD29 (TS2/16)

CD29 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65191-1-5C
Clone No.TS2/16

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD29, FNRB, GPIIA, Integrin beta 1, ITGB1, MDF2, MSK12, VLA 4 subunit beta, VLA BETA, VLAB

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65191-1-5C targets CD29 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD29 (TS2/16)
Calculated Molecular Weight 88 kDa
GenBank Accession NumberBC020057
Gene Symbol Integrin beta 1
Gene ID (NCBI) 3688
ENSEMBL Gene IDENSG00000150093
RRIDAB_3673929
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTGAGAGACACGCATCCCCATATAAGAAA
Barcode SequenceTGAGAGACACGCATC
Form Liquid
UNIPROT IDP05556
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Integrin beta-1 (ITGB1), also named as CD29, is a 130 kDa single chain type I glycoprotein that is expressed in a heterodimeric complex with one of six distinct α subunits, comprising the very late activation antigen (VLA) subfamily of adhesion receptors. It is one of the essential surface molecules expressed on human MSC from bone marrow and other sources. The β1 subunit is also broadly expressed on lymphocytes and monocytes, weakly expressed on granulocytes, and not expressed on erythrocytes. These receptors are involved in a variety of cell-cell and cell-matrix interactions.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...