MultiPro® 5CFLX Anti-Human CD28 (CD28.2)

• 

  Single Cell Sequencing experiment G65099-1-5C on Resting PBMC

  G65099-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65099-1-5C on PBMC treated with 4hr LPS + TI

  G65099-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65099-1-5C on Resting PBMC

  G65099-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65099-1-5C on PBMC treated with 4hr LPS + TI

  G65099-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD28 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65099-1-5C

Clone No.CD28.2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD28, CD28 molecule, Tp44

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65099-1-5C targets CD28 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: N/A
• Full Name: MultiPro® 5CFLX Anti-Human CD28 (CD28.2)
• Calculated Molecular Weight: 220 aa, 25 kDa
• GenBank Accession Number: BC093698
• Gene Symbol: CD28
• Gene ID (NCBI): 940
• ENSEMBL Gene ID: ENSG00000178562
• RRID: AB_3673912
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTTATCGCAACGTTACCCATATAAGAAA
• Barcode Sequence: GTTATCGCAACGTTA
• Form: Liquid
• UNIPROT ID: P10747
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD28 (T-cell-specific surface glycoprotein CD28), also known as T44 and Tp44, is a 44 kD disulfide-linked homodimeric type I glycoprotein (PMID: 2162180). It is a member of the immunoglobulin superfamily and is expressed on most T lineage cells, NK cell subsets, and plasma cells (PMID: 2162180, 8386518). CD28 may affect in vivo immune responses by functioning both as a cell adhesion molecule linking B and T lymphocytes and as the surface component of a novel signal transduction pathway (PMID: 2162180, 3021470). CD28 binds both CD80 and CD86 with a highly conserved motif MYPPY in the CDR3-like loop (PMID: 15696168, 7964482). CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death (PMID: 1348520).