MultiPro® 5CFLX Anti-Human CD27 (1C1G3)

CD27 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G66308-1-5C
Clone No.1C1G3

Host / Isotype

Mouse / IgG1

Reactivity

Human

CD27, CD27 antigen, CD27 molecule, CD27L receptor, S152, T cell activation antigen CD27, T14, TNFRSF7, Tp55

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66308-1-5C targets CD27 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen CD27 fusion protein Ag24537 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD27 (1C1G3)
Calculated Molecular Weight 29 kDa
GenBank Accession NumberBC012160
Gene Symbol CD27
Gene ID (NCBI) 939
ENSEMBL Gene IDENSG00000139193
RRIDAB_3673946
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTGTGAGCGCAATCAGCCCATATAAGAAA
Barcode SequenceTGTGAGCGCAATCAG
Form Liquid
UNIPROT IDP26842
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD27 (also known as TNFRSF7) is a type I glycoprotein expressed on some B cells and the majority of T cells, and is a member of the tumor necrosis factor (TNF) receptor family. CD27 is required for generation and long-term maintenance of T cell immunity (PMID: 11062504). It is a receptor for CD70 (CD27L). Ligation of CD27 by CD70 induces strong ubiquitination of TRAF and the activation of both canonical and non-canonical NF-kappaB pathways, as well as the JNK pathway (PMID: 19426224). CD27 may also play a role in apoptosis through association with SIVA1.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...