MultiPro® 5CFLX Anti-Human CD226 (11A8)

• 

  Single Cell Sequencing experiment G65247-1-5C on Resting PBMC

  G65247-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65247-1-5C on PBMC treated with 4hr LPS + TI

  G65247-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD226 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65247-1-5C

Clone No.11A8

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD226, CD226 antigen, CD226 molecule, DNAM 1, DNAM1, DNAX accessory molecule 1, PTA1, TLiSA1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65247-1-5C targets CD226 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Human NK Cells
• Full Name: MultiPro® 5CFLX Anti-Human CD226 (11A8)
• Calculated Molecular Weight: 336 aa, 39 kDa
• GenBank Accession Number: BC074787
• Gene Symbol: CD226
• Gene ID (NCBI): 10666
• ENSEMBL Gene ID: ENSG00000150637
• RRID: AB_3673938
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTACTTATACGGAACCCATATAAGAAA
• Barcode Sequence: ATTACTTATACGGAA
• Form: Liquid
• UNIPROT ID: Q15762
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD226 (DNAM-1) is a ~65 kDa glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. CD226 mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Interactions of CD226 and its ligands, CD155 and CD112, induce NK and T cell-mediated cytotoxicity and cytokine secretion (PMID: 15039383).