MultiPro® 5CFLX Anti-Human CD226 (11A8)

CD226 Monoclonal Antibody for Single Cell (Intra)
Cat No. G65247-1-5C
Clone No.11A8

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

CD226, CD226 antigen, CD226 molecule, DNAM 1, DNAM1, DNAX accessory molecule 1, PTA1, TLiSA1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

In stock at manufacturing site. Delivery in 3-4 weeks.

Freight/Packing: $40.00

Quantity

Buy two full size antibodies and get a third full size primary antibody for free. Use promo code B2G125.


Proteintech Guarantee



Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65247-1-5C targets CD226 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human NK Cells Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD226 (11A8)
Calculated Molecular Weight 336 aa, 39 kDa
GenBank Accession NumberBC074787
Gene Symbol CD226
Gene ID (NCBI) 10666
ENSEMBL Gene IDENSG00000150637
RRIDAB_3673938
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGATTACTTATACGGAACCCATATAAGAAA
Barcode SequenceATTACTTATACGGAA
Form Liquid
UNIPROT IDQ15762
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD226 (DNAM-1) is a ~65 kDa glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. CD226 mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Interactions of CD226 and its ligands, CD155 and CD112, induce NK and T cell-mediated cytotoxicity and cytokine secretion (PMID: 15039383).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...