MultiPro® 5CFLX Anti-Human CD21 (BU32)

• 

  Single Cell Sequencing experiment G65198-1-5C on Resting PBMC

  G65198-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65198-1-5C on PBMC treated with 4hr LPS + TI

  G65198-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65198-1-5C on Resting PBMC

  G65198-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65198-1-5C on PBMC treated with 4hr LPS + TI

  G65198-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD21 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65198-1-5C

Clone No.BU32

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

C3DR, CD21, Complement C3d receptor, Complement receptor type 2, CR2, EBV receptor, Epstein Barr virus receptor, SLEB9

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65198-1-5C targets CD21 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  N/A

• Full Name: MultiPro® 5CFLX Anti-Human CD21 (BU32)
• Calculated Molecular Weight: 1092 aa, 119 kDa
• GenBank Accession Number: BC136394
• Gene Symbol: CD21
• Gene ID (NCBI): 1380
• ENSEMBL Gene ID: ENSG00000117322
• RRID: AB_3673933
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACAATAATGTCAACCCATATAAGAAA
• Barcode Sequence: CCACAATAATGTCAA
• Form: Liquid
• UNIPROT ID: P20023
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD21, also known as complement receptor type 2 (CR2), complement C3d receptor, and Epstein-Barr virus receptor, is a transmembrane protein that contains a small cytoplasmic domain, a transmembrane region and an extracellular domain consisting of 15 tandem short consensus repeat sequences (PMID: 6230668; 2551147). It is expressed on B cells, follicular dendritic cells, thymocytes and a subset of peripheral T cells (PMID: 26119182). CD21 binds complement fragments C3d, C3dg and iC3b and acts as a receptor for the Epstein-Barr virus (PMID: 7753047). On B cells, together with CD19 and CD81, CD21 forms a complex that functions as a co-receptor to the BCR (PMID: 7542009). It is involved in B cells activation and functions.