MultiPro® 5CFLX Anti-Human CD2 (TS1/8)

• 

  Single Cell Sequencing experiment G65192-1-5C on Resting PBMC

  G65192-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65192-1-5C on PBMC treated with 4hr LPS + TI

  G65192-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65192-1-5C on Resting PBMC

  G65192-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65192-1-5C on PBMC treated with 4hr LPS + TI

  G65192-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD2 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65192-1-5C

Clone No.TS1/8

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD2, CD2 molecule, Erythrocyte receptor, FLJ46032, LFA 2, LFA 3 receptor, Rosette receptor, SRBC, T cell surface antigen CD2, T11

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65192-1-5C targets CD2 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: N/A
• Full Name: MultiPro® 5CFLX Anti-Human CD2 (TS1/8)
• Calculated Molecular Weight: 351 aa, 39 kDa
• GenBank Accession Number: BC033583
• Gene Symbol: CD2
• Gene ID (NCBI): 914
• ENSEMBL Gene ID: ENSG00000116824
• RRID: AB_3673930
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTAGAGACAGTTATAACCCATATAAGAAA
• Barcode Sequence: TAGAGACAGTTATAA
• Form: Liquid
• UNIPROT ID: P06729
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD2 is a cell surface glycoprotein present on a majority of thymocytes, all mature T cells and subset of NK cells but not on B lymphocytes. It is a pan T-cell marker. CD2 interacts with lymphocyte function-associated antigen (LFA-3/CD58) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain is implicated in the signaling function.