MultiPro® 5CFLX Anti-Human CD16 (3G8)

CD16 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65090-1-5C
Clone No.3G8

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD16, CD16A, CD16a antigen, CD16B, CD16b antigen, Fc gamma RIII, Fc gamma RIII alpha, Fc gamma RIIIa, FCG3, FCGR3, FCGR3A, FCGRIII, FCR 10, FCRIII, FCRIIIA, IGFR3, IgG Fc receptor III 2

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65090-1-5C targets CD16 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD16 (3G8)
Calculated Molecular Weight 254 aa, 29 kDa
GenBank Accession NumberBC017865
Gene Symbol CD16a
Gene ID (NCBI) 2214
ENSEMBL Gene IDENSG00000203747
RRIDAB_3673911
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGGTGTGGAGTCTGGATCCCATATAAGAAA
Barcode SequenceGTGTGGAGTCTGGAT
FormLiquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD16 is a 50-70-kDa low affinity Fc receptor found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. CD16 mediates antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses, such as phagocytosis. CD16 has been identified as Fc receptors FcγRIIIa (CD16a) and FcγRIIIb (CD16b), encoded by two nearly identical genes, FCGR3A and the FCGR3B. Clone 3G8 recognizes both the CD16a and CD16b (PMID: 7592758).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...