MultiPro® 5CFLX Anti-Human CD16 (3G8)

• 

  Single Cell Sequencing experiment G65090-1-5C on Resting PBMC

  G65090-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65090-1-5C on PBMC treated with 4hr LPS + TI

  G65090-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65090-1-5C on Resting PBMC

  G65090-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65090-1-5C on PBMC treated with 4hr LPS + TI

  G65090-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD16 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65090-1-5C

Clone No.3G8

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD16, CD16A, CD16a antigen, CD16B, CD16b antigen, Fc gamma RIII, Fc gamma RIII alpha, Fc gamma RIIIa, FCG3, FCGR3, FCGR3A, FCGRIII, FCR 10, FCRIII, FCRIIIA, IGFR3, IgG Fc receptor III 2

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65090-1-5C targets CD16 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: N/A
• Full Name: MultiPro® 5CFLX Anti-Human CD16 (3G8)
• Calculated Molecular Weight: 254 aa, 29 kDa
• GenBank Accession Number: BC017865
• Gene Symbol: CD16a
• Gene ID (NCBI): 2214
• ENSEMBL Gene ID: ENSG00000203747
• RRID: AB_3673911
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGTGGAGTCTGGATCCCATATAAGAAA
• Barcode Sequence: GTGTGGAGTCTGGAT
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD16 is a 50-70-kDa low affinity Fc receptor found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. CD16 mediates antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses, such as phagocytosis. CD16 has been identified as Fc receptors FcγRIIIa (CD16a) and FcγRIIIb (CD16b), encoded by two nearly identical genes, FCGR3A and the FCGR3B. Clone 3G8 recognizes both the CD16a and CD16b (PMID: 7592758).