MultiPro® 5CFLX Anti-Human CD13 (WM15)

• 

  Single Cell Sequencing experiment G65186-1-5C on Resting PBMC

  G65186-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65186-1-5C on PBMC treated with 4hr LPS + TI

  G65186-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65186-1-5C on Resting PBMC

  G65186-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65186-1-5C on PBMC treated with 4hr LPS + TI

  G65186-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD13 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65186-1-5C

Clone No.WM15

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

Alanyl aminopeptidase, Aminopeptidase M, Aminopeptidase N, ANPEP, AP M, AP N, APN, CD13, gp150, hAPN, LAP1, Microsomal aminopeptidase, p150, PEPN

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65186-1-5C targets CD13 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Human AML cells
• Full Name: MultiPro® 5CFLX Anti-Human CD13 (WM15)
• Calculated Molecular Weight: 110 kDa
• GenBank Accession Number: BC058928
• Gene Symbol: CD13
• Gene ID (NCBI): 290
• ENSEMBL Gene ID: ENSG00000166825
• RRID: AB_3673927
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTAATGAGTAGAGCGCCCATATAAGAAA
• Barcode Sequence: TTAATGAGTAGAGCG
• Form: Liquid
• UNIPROT ID: P15144
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD13, also named as APN, ANPEP (aminopeptidase N) or PEPN, is belongs to the peptidase M1 family. CD13 is a heavily glycosylated, ~150-240 kDa, type-II membrane, expressed by most cells of myeloid origin including monocytes, macrophages, granulocytes, and their hematopoietic precursors. It is also abundantly expressed in the brush border of epithelial cells from renal proximal tubules and small intestine, in prostatic epithelial cells, in bile duct canaliculi, in mast cells, and, in some cases, in fibroblasts and smooth muscle cells. CD13 is a multifunctional protein and plays varying roles in cell migration, cell proliferation, cell differentiation and so on. CD13 participates in angiogenesis generating and modulating angiogenic signals, and can be a marker of angiogenic vessels. CD13 is also a pan-myeloid marker, present on mature granulocytes and monocytes. (PMID: 8805662, 10098327, 18603472, 18097955, 17897790, 17888402, 21339174)