MultiPro® 5CFLX Anti-Human CD13 (WM15)

CD13 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65186-1-5C
Clone No.WM15

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Alanyl aminopeptidase, Aminopeptidase M, Aminopeptidase N, ANPEP, AP M, AP N, APN, CD13, gp150, hAPN, LAP1, Microsomal aminopeptidase, p150, PEPN

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65186-1-5C targets CD13 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human AML cells Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD13 (WM15)
Calculated Molecular Weight 110 kDa
GenBank Accession NumberBC058928
Gene Symbol CD13
Gene ID (NCBI) 290
ENSEMBL Gene IDENSG00000166825
RRIDAB_3673927
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTTAATGAGTAGAGCGCCCATATAAGAAA
Barcode SequenceTTAATGAGTAGAGCG
Form Liquid
UNIPROT IDP15144
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD13, also named as APN, ANPEP (aminopeptidase N) or PEPN, is belongs to the peptidase M1 family. CD13 is a heavily glycosylated, ~150-240 kDa, type-II membrane, expressed by most cells of myeloid origin including monocytes, macrophages, granulocytes, and their hematopoietic precursors. It is also abundantly expressed in the brush border of epithelial cells from renal proximal tubules and small intestine, in prostatic epithelial cells, in bile duct canaliculi, in mast cells, and, in some cases, in fibroblasts and smooth muscle cells. CD13 is a multifunctional protein and plays varying roles in cell migration, cell proliferation, cell differentiation and so on. CD13 participates in angiogenesis generating and modulating angiogenic signals, and can be a marker of angiogenic vessels. CD13 is also a pan-myeloid marker, present on mature granulocytes and monocytes. (PMID: 8805662, 10098327, 18603472, 18097955, 17897790, 17888402, 21339174)

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...