MultiPro® 5CFLX Anti-Human CD127/IL-7R (Polyclonal)

• 

  Single Cell Sequencing experiment G17626-1-5C on Resting PBMC

  G17626-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G17626-1-5C on PBMC treated with 4hr LPS + TI

  G17626-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD127/IL-7R Polyclonal Antibody for Single Cell (Intra)

Cat No. G17626-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD127, CDW127, IL 7 receptor subunit alpha, IL 7R alpha, IL 7R subunit alpha, IL 7RA, IL7R, IL-7R, IL7RA, ILRA, interleukin 7 receptor

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G17626-1-5C targets CD127/IL-7R in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: CD127/IL-7R fusion protein Ag11844
• Full Name: MultiPro® 5CFLX Anti-Human CD127/IL-7R (Polyclonal)
• Calculated Molecular Weight: 459 aa, 52 kDa
• GenBank Accession Number: BC067537
• Gene Symbol: CD127
• Gene ID (NCBI): 3575
• ENSEMBL Gene ID: ENSG00000168685
• RRID: AB_3673892
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGGCTCGGACCATAGCCCATATAAGAAA
• Barcode Sequence: CGGCTCGGACCATAG
• Form: Liquid
• UNIPROT ID: P16871
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD127, also known as IL-7R subunit alpha (IL-7RA), is a type I membrane glycoprotein expressed on thymocytes, B cell precursors, most T cells, and some lymphoid and myeloid cells. IL-7R is a heterodimer composed of CD127 and the common-γ chain receptor (CD132). IL-7R plays critical roles in lymphocyte development and homeostasis. CD127 can also act as a receptor for thymic stromal lymphopoietin (TSLP).