MultiPro® 5CFLX Anti-Human CD11c (3.9)

• 

  Single Cell Sequencing experiment G65086-1-5C on Resting PBMC

  G65086-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65086-1-5C on PBMC treated with 4hr LPS + TI

  G65086-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65086-1-5C on Resting PBMC

  G65086-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65086-1-5C on PBMC treated with 4hr LPS + TI

  G65086-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD11c Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65086-1-5C

Clone No.3.9

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD11C, Integrin alpha X, ITGAX, Leu M5, SLEB6

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65086-1-5C targets CD11c in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  Rheumatoid synovial cells and human monocytes

• Full Name: MultiPro® 5CFLX Anti-Human CD11c (3.9)
• Calculated Molecular Weight: 1169 aa, 129 kDa
• GenBank Accession Number: BC038237
• Gene Symbol: CD11c
• Gene ID (NCBI): 3687
• ENSEMBL Gene ID: ENSG00000140678
• RRID: AB_3673910
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAAGCAATACTTATACCCCATATAAGAAA
• Barcode Sequence: AAGCAATACTTATAC
• Form: Liquid
• UNIPROT ID: P20702
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11c, also known as integrin αX, is a type I transmembrane glycoprotein present on a variety of cells, including monocytes/macrophages, granulocytes, a subset of B cells, NK cells and dendritic cells (PMID: 2897326; 1680915; 1694698; 17389580). As a result of its high level of expression on most dendritic cells, CD11c is typically considered to be a marker of conventional dendritic cells (PMID: 27119555). CD11c forms an α/β heterodimer with CD18 (integrin β2). CD11c/CD18 acts a receptor for fibrinogen and is important in monocyte adhesion and chemotaxis (PMID: 1671533).