MultiPro® 5CFLX Anti-Human CD11c (3.9)

CD11c Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65086-1-5C
Clone No.3.9

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD11C, Integrin alpha X, ITGAX, Leu M5, SLEB6

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65086-1-5C targets CD11c in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Rheumatoid synovial cells and human monocytes Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD11c (3.9)
Calculated Molecular Weight 1169 aa, 129 kDa
GenBank Accession NumberBC038237
Gene Symbol CD11c
Gene ID (NCBI) 3687
ENSEMBL Gene IDENSG00000140678
RRIDAB_3673910
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGAAGCAATACTTATACCCCATATAAGAAA
Barcode SequenceAAGCAATACTTATAC
Form Liquid
UNIPROT IDP20702
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11c, also known as integrin αX, is a type I transmembrane glycoprotein present on a variety of cells, including monocytes/macrophages, granulocytes, a subset of B cells, NK cells and dendritic cells (PMID: 2897326; 1680915; 1694698; 17389580). As a result of its high level of expression on most dendritic cells, CD11c is typically considered to be a marker of conventional dendritic cells (PMID: 27119555). CD11c forms an α/β heterodimer with CD18 (integrin β2). CD11c/CD18 acts a receptor for fibrinogen and is important in monocyte adhesion and chemotaxis (PMID: 1671533).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...