MultiPro® 5CFLX Anti-Human CD11a (TS2/4)

• 

  Single Cell Sequencing experiment G65194-1-5C on Resting PBMC

  G65194-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65194-1-5C on PBMC treated with 4hr LPS + TI

  G65194-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65194-1-5C on Resting PBMC

  G65194-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD11a Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65194-1-5C

Clone No.TS2/4

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD11A, Integrin alpha L, ITGAL, LFA 1, LFA 1A, LFA1A

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65194-1-5C targets CD11a in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  HLA-DR CTL line

• Full Name: MultiPro® 5CFLX Anti-Human CD11a (TS2/4)
• Calculated Molecular Weight: 129 kDa
• GenBank Accession Number: BC008777
• Gene Symbol: CD11a
• Gene ID (NCBI): 3683
• ENSEMBL Gene ID: ENSG00000005844
• RRID: AB_3673931
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACTAGATGCTTGGCCCATATAAGAAA
• Barcode Sequence: CCACTAGATGCTTGG
• Form: Liquid
• UNIPROT ID: P20701
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD11a, also known as integrin αL or LFA-1α, is a 170-180 kDa transmembrane glycoprotein that forms a heterodimer with CD18 (PMID: 7027264; 1672643). CD11a/CD18 (LFA-1) is expressed by all leukocytes and mediates cell adhesion through interactions with its ligands, intercellular adhesion molecule 1 (ICAM-1), ICAM-2, and ICAM-3 (PMID: 7479767). CD11a/CD18 also functions in lymphocyte costimulatory signaling (PMID: 1972160).