MultiPro® 5CFLX Anti-Human CD107a/LAMP1 (H4A3)

CD107a / LAMP1 Monoclonal Antibody for Single Cell (Intra)
Cat No. G65051-1-5C
Clone No.H4A3

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

CD107a, Cell and organelle markers, LAMP 1, LAMP1, LAMPA, LGP120, lysosomal marker, Lysosome Marker

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65051-1-5C targets CD107a / LAMP1 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human adherent peripheral blood cells Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD107a/LAMP1 (H4A3)
Calculated Molecular Weight45 kDa
GenBank Accession NumberBC006345
Gene Symbol LAMP1
Gene ID (NCBI) 3916
ENSEMBL Gene IDENSG00000185896
RRIDAB_3673904
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTACTTCGGATTATATCCCATATAAGAAA
Barcode SequenceTACTTCGGATTATAT
Form Liquid
UNIPROT IDP11279
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

LAMP1 (CD107a) is a heavily glycosylated membrane protein enriched in the lysosomal membrane. LAMP1 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP1 is expressed largely in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane (PMID: 16168398). Elevated LAMP1 expression at the cell surface has also been detected during platelet and granulocytic cell activation, as well as in some tumor cells (PMID: 29085473). LAMP1 functions to provide selectins with carbohydrate ligands. This protein has also been shown to be a marker of degranulation on lymphocytes such as CD8+ and NK cells and may also play a role in tumor cell differentiation and metastasis (PMID: 18835598; 29085473; 9426697).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...