MultiPro® 5CFLX Anti-Human Beta-2-Microglobulin (Polyclonal)

• 

  Single Cell Sequencing experiment G13511-1-5C on Resting PBMC

  G13511-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G13511-1-5C on PBMC treated with 4hr LPS + TI

  G13511-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G13511-1-5C on Resting PBMC

  G13511-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G13511-1-5C on PBMC treated with 4hr LPS + TI

  G13511-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

Beta-2-Microglobulin Polyclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G13511-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

B2M, Beta-2-microglobulin, HDCMA22P

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G13511-1-5C targets Beta-2-Microglobulin in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Rabbit / IgG
• Class: Oligo Conjugate
• Type: Polyclonal
• Immunogen: Beta-2-Microglobulin fusion protein Ag4433
• Full Name: MultiPro® 5CFLX Anti-Human Beta-2-Microglobulin (Polyclonal)
• Calculated Molecular Weight: 119 aa, 14 kDa
• GenBank Accession Number: BC032589
• Gene Symbol: B2M
• Gene ID (NCBI): 567
• ENSEMBL Gene ID: ENSG00000166710
• RRID: AB_3673883
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGACATATGCGATAGAACCCATATAAGAAA
• Barcode Sequence: ACATATGCGATAGAA
• Form: Liquid
• UNIPROT ID: P61769
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Beta-2-microglobulin (B2M) is a component of MHC class I molecules, which are present on the surface of nearly all nucleated cells. It can be found in body fluids under physiologic conditions as a result of shedding from cell surfaces or intracellular release. B2M has various biological functions, including antigen presentation. Investigations reveal that increased synthesis and release of B2M are present in several malignant diseases.