MultiPro® 5CFLX Anti-Human Annexin A2 (1C1E12)

• 

  Single Cell Sequencing experiment G66035-1-5C on Resting PBMC

  G66035-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66035-1-5C on PBMC treated with 4hr LPS + TI

  G66035-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

Annexin A2 Monoclonal Antibody for Single Cell (Intra)

Cat No. G66035-1-5C

Clone No.1C1E12

Host / Isotype

Mouse / IgG2a

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

Annexin 2, annexin A2, Annexin II, ANX2, ANX2L4, ANXA2, CAL1H, Calpactin 1 heavy chain, Calpactin I heavy chain, Chromobindin 8, LIP2, Lipocortin II, LPC2, LPC2D, P36, PAP IV, Protein I

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66035-1-5C targets Annexin A2 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Annexin A2 fusion protein Ag16654
• Full Name: MultiPro® 5CFLX Anti-Human Annexin A2 (1C1E12)
• Calculated Molecular Weight: 339 aa, 39 kDa
• GenBank Accession Number: BC016774
• Gene Symbol: Annexin A2
• Gene ID (NCBI): 302
• ENSEMBL Gene ID: ENSG00000182718
• RRID: AB_3673941
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTCAACTGAGTCCGCCCATATAAGAAA
• Barcode Sequence: GGTCAACTGAGTCCG
• Form: Liquid
• UNIPROT ID: P07355
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Annexin A2 (ANXA2), also named Annexin-2 or Lipocortin II, is a Ca2+ binding protein that is up-regulated in virally transformed cell lines and human tumors. This calcium-regulated membrane-binding protein, whose affinity for calcium is greatly enhanced by anionic phospholipids, may cross-link plasma membrane phospholipids with actin and the cytoskeleton and be involved with exocytosis. Heat-stress response may also involve Annexin-2.